Friday, September 6, 2019
The Handmaids Tale Essay Example for Free
The Handmaids Tale Essay Gileadââ¬â¢s totalitarianism regime uses religion to meet the ends of the regime, rather than the regime being a means to serve God. ââ¬ËSoul Scrollsââ¬â¢ is a place where Handmaidââ¬â¢s purchase one of five prayers to be read to them, before being recycled. Offredââ¬â¢s prayer is a distortion of the Lordââ¬â¢s Prayer which is ostensibly much more personal to her. Offred describes ââ¬ËSoul Scrollsââ¬â¢ as ââ¬Ëa franchiseââ¬â¢. This suggests the presence of business and technology in Gilead, reinforced by the idea that the Handmaidââ¬â¢s accounts are debited and that the regime is everywhere. This concept of business is continuous throughout the novel, for example the ââ¬Ëceremonyââ¬â¢ previously discussed is portrayed to be a business transaction. ââ¬ËFranchiseââ¬â¢ has connotations of something which is unavoidable. Everybody knows it and everybody has access to it, and itââ¬â¢s the same everywhere you go ââ¬â itââ¬â¢s incredibly impersonal. Gilead uses ââ¬ËSoul Scrollsââ¬â¢ as a means of controlling the Handmaids. There is no flexibility because there is no choice in prayer ââ¬â there are only five prayers to choose from, which seems quite artificial. In only offering five exact choices ââ¬â ââ¬Ëhealth, wealth, a death, a birth, a sinââ¬â¢, it prevents people praying for anything else. Despite the fact that the Handmaidââ¬â¢s can mentally think of other prayers, they can never articulate this because their freedom of speech is subverted to the state of Gilead. ââ¬ËBirthââ¬â¢ and ââ¬Ëdeathââ¬â¢ are rites of passage and for the Handmaidââ¬â¢s; itââ¬â¢s the only two things they can be certain of. They exist simply for the purpose to bear children, and constant reminders of the consequences if they fail to conceive are that they will eventually die. With only 5 prayers available, this creates uniformity which shows how Gilead manipulates religion, because in reality, prayer should be different for everyone. The concept of Christianity is based on the relationship between God and the person. Prayer is theoretically supposed to be a means of personal communication, a way to thank God, and to wish for things to happen. ââ¬ËSoul Scrollsââ¬â¢ is not personal. ââ¬ËThe machines talkââ¬â¢ and by speaking in a ââ¬Ëtoneless metallic voiceââ¬â¢, Gilead is taking all freedom from the Handmaidââ¬â¢s minds, and this autonomy removes any need for a thought process, which means the Handmaidââ¬â¢s cannot threaten the Gilead regime by thinking for themselves. ââ¬ËSoul Scrollsââ¬â¢ allegedly teach the Handmaidsââ¬â¢ what they should think. However, their soul is a part of them and they should already know what they want to think, but the absence of this suggests the influence and power of Gilead. The idea that the Handmaidsââ¬â¢ minds are also controlled is emphasised by this because Gilead doesnââ¬â¢t let them develop, it uses machines and the role of people such as auntââ¬â¢s and commanders to brainwash them. Regardless of the Handmaidsââ¬â¢ being unable to express their thoughts, since God is omniscient he should know what theyââ¬â¢re thinking. However, in articulating their thoughts they could confirm their own beliefs to themselves in a pragmatic way. It forms a part of positive thinking in the concept that the more you repeat it the better a chance they have of getting what they want. There is also a value in articulating feelings to people you love because itââ¬â¢s comforting. God is a conscious living entity aware of peopleââ¬â¢s love. Nevertheless, Gilead completely restricts this because the Handmaidsââ¬â¢ have been brainwashed for so long that itââ¬â¢s wrong to think and to have these feelings, and so this restricts the power that the Handmaidsââ¬â¢ could have. ââ¬ËSoul scrollsââ¬â¢ is only one way communication from the machine to the Handmaid, and this stops them developing thoughts, making the ââ¬ËSoul Scrollsââ¬â¢ simply another way of controlling the Handmaids. ââ¬ËSoul Scrollsââ¬â¢ are described by the Wives to ââ¬Ëhelp their husbandââ¬â¢s careerââ¬â¢, which shows the machines to be pragmatic and simply a way to get ahead and follow the regime. ââ¬ËSoul Scrollsââ¬â¢ also suggests that the regime is manipulative because it shows a yearning for money and power in charging for the prayers to be read, and in controlling the Handmaidsââ¬â¢. In buying prayers, itââ¬â¢s a sign of faithfulness to the regime, which implies that the regime has completely replaced religion and which emphasises that the Commander is thought to be like a God. Gilead completely distorts the meaning of prayer because with ââ¬ËSoul Scrollsââ¬â¢ itââ¬â¢s not about connecting with God, and in prayer you should want to pray which is not what this is about. Atwoodââ¬â¢s repetition of ââ¬Ëpunching in the numbersââ¬â¢ reinforces this sense of autonomy and contempt for the regime, because it appears repetitive and tedious. Offred describes it as having ââ¬Ëroll upon rollââ¬â¢ of prayers, which shows Gilead believes in quantity not quality, further emphasising the concept of business and money. Gileadââ¬â¢s regime is described as indestructible. ââ¬ËThe window of ââ¬ËSoul scrollsââ¬â¢ is shatterproofââ¬â¢, which suggests that for the regime to have protected the franchise, they must have feared there would be dissenters. It suggests that not everybody in Gilead accepts it but they donââ¬â¢t dare to express this because of the consequences. There is reference to the spies in ââ¬ËSoul Scrollsââ¬â¢, ââ¬Ëeach machine has an eye painted in gold on the sideââ¬â¢, which shows their superiority and that the Handmaidsââ¬â¢ are always being watched ââ¬â there is no escape and this is yet another means of controlling them. Offred tries ââ¬Ëto rememberââ¬â¢ what the place sold before and realises it was a lingerie shop. This takes away the feminist aspect of women because Gilead attempts to strip women of any wants and thoughts, to make them only want to bear children. If a lingerie shop existed in Gileadââ¬â¢s society as it were then, it would be considered corrupt, which is ironic because Gilead itself is a mire of corruption. The concept of a patriarchal society is reinforced in that ââ¬Ëmost of the stores carrying things for men are still openââ¬â¢. Offredââ¬â¢s parody of the Lordââ¬â¢s Prayer, which takes place by an empty garden (similar to how Jesus prayed alone in the Garden of Gethsemane), articulates Offredââ¬â¢s feelings of abandonment and despair. Line by line, such as ââ¬ËWho Art in the kingdom of heavenââ¬â¢, she regurgitates the sentiments of the Lordââ¬â¢s Prayer, typically used at ceremonies (the irony being in comparison to her experience of ceremonies), and in private commitment to express needs and hopes. Offred dwells on metaphors of ââ¬Ëheavenââ¬â¢, ââ¬Ëhellââ¬â¢, ââ¬Ëdaily breadââ¬â¢, and ââ¬Ëforgivenessââ¬â¢, from which arises a vision of the absent chandelier where her predecessor attached a noose. This shows Offredââ¬â¢s despair because throughout a hopeful prayer she arrives at the conclusion that dying is the only option. Offred tediously recites the recurrent line from a tombstone in Gileadââ¬â¢s cemetery, and despite her attempts to remain ââ¬ËIn hopeââ¬â¢; Offred suffers so much isolation that her prayer becomes a desperate cry for spiritual nourishment. Offred concludes with a plaintive rhetorical question, ââ¬ËHow can I keep on living? ââ¬â¢ which emphasises her unhappiness within Gilead and her want to end it all. Offred continually refers to God as ââ¬ËYouââ¬â¢, which shows her yearning to be personal with God and to have a personal relationship. Atwood refers God as ââ¬Ëyouââ¬â¢ because it personifies God showing Offred as trying to talk to him personally. She wishes she knew ââ¬ËYour nameââ¬â¢, which implies she needs God to answer her. She describes her thoughts as ââ¬Ëhell we can make for ourselvesââ¬â¢, which suggests that the hell is Gilead itself. Offred is uncertain about her capacity to find out about whatââ¬â¢s happening in Gilead. ââ¬ËThe Fall was a fall from innocence to knowledgeââ¬â¢ is a reference to Adam and Eveââ¬â¢s loss of innocence after they disobeyed God and tasted the Tree of Knowledge. Offred applies this to herself because Gilead teaches that knowledge is dire and that they will no longer be innocent if they think such knowledge (the irony being that they were never innocent in Gileadââ¬â¢s corrupt regime). This suggests that if Offred was to find out about what was happening, this would be a sin, and this also reinforces Gileadââ¬â¢s influence in terms of how they brainwash the Handmaidsââ¬â¢ with bible stories. Offred avoids the ââ¬Ëtraditionalââ¬â¢ posture of praying ââ¬ËI donââ¬â¢t even close my eyesââ¬â¢. This is because it would draw attention to her and also shows that she is afraid of the consequences if she was found to be personally praying, and so this informal prayer becomes her only way of communicating with God. The ââ¬Ëequal darknessââ¬â¢ even when her eyes are closed implies that nothing goes away because itââ¬â¢s too hard. However, there is potential optimism within Offred. ââ¬ËOr lightââ¬â¢ suggests that there could be hope for Offred, except that Gilead takes this hope. This informal way of praying seems like sheââ¬â¢s not fully committed but she still wants to pray because sheââ¬â¢s desperate. ââ¬ËSoul scrollsââ¬â¢ is very impersonal in comparison to Offredââ¬â¢s own prayer. All thought process is removed, unlike how Offred can reflect in her mind during her own prayer. In her own prayer, despite Offred not being completely committed, she does get the opportunity to think about whatââ¬â¢s happening in Gilead. In ââ¬ËSoul Scrollsââ¬â¢, Offred cannot do this because she may be caught and also because the autonomous voices prevent her from thinking. Offredââ¬â¢s own prayer becomes much like a desperate cry for help and the purpose of her prayer is to portray to the reader just how distressed she is. On the other hand, Offred commits to ââ¬ËSoul Scrollsââ¬â¢ because she has too since itââ¬â¢s a sign of faithfulness to Gileadââ¬â¢s regime, and if she didnââ¬â¢t, it would seem suspicious, even if she doesnââ¬â¢t believe in doing it. However, both do criticise Gilead, with ââ¬ËSoul Scrollsââ¬â¢ expressing the pointlessness of it, and her own personal prayer expressing how Gilead is a hell. In her own personal prayer, Offred has hope for two way communications, and although his name is not known, God does offer some kind of contemplation for Offred, as she works her way through her feelings. ââ¬ËSoul scrollsââ¬â¢ is simply a one way communication because prayers are printed and read to the Handmaidsââ¬â¢ before being recycled, which shows the uniformity of this prayer. Offredââ¬â¢s own prayer is also in a sense a rebellion from the constraints of Gilead, because although this isnââ¬â¢t her aim, it does go against what Gilead teaches ââ¬â that she should not be thinking for herself. When Offred visits ââ¬ËSoul Scrollsââ¬â¢, she is complying with the ways of Gilead simply to stay out of trouble. In conclusion, Offredââ¬â¢s personal prayer is much more personal than ââ¬ËSoul Scrollsââ¬â¢, and despite it being a distorted version of the Lordââ¬â¢s prayer, it does signify her desperation for salvation from the regime. ââ¬ËSoul Scrollsââ¬â¢ is something Offred simply goes along with because she has no choice but too, and this offers her no answers to her thoughts because of how autonomous and controlled it is.
Thursday, September 5, 2019
The Last Lecture: Dr Randy Pausch
The Last Lecture: Dr Randy Pausch Carnegie Mellon University asked a set of Professors to give a message of a lifetime as if it was their last lecture before their death. Ironically for Dr. Randy Pausch, it was his last lecture because he had learned that he is going to die soon due to Pancreatic Cancer that has spread to his liver. That is what it is we cannot change that, we just have to deal with it. Dr. Pauschs inspirational speech was not about death; it was about life and how to achieve your childhood dreams. His sense of humor and enthusiasm is what triggered the audience to become inspired with his life lessons. Randy Pausch started off his speech by introducing the elephant in the room which he told the audience that he has been diagnosed with pancreatic cancer and will die soon because of it. He chose to tell them about the cancer at the beginning because he believes that if there are issues distracting your audience, address them sooner rather than later. He says that we have to deal with what we are facing because it is not in our hands to change the future. Therefore, instead of feeling depressed, we should try to enjoy the time that we have left. If I do not seem depressed as I should be, sorry to disappoint you. He makes it clear that he is not in denial of whats going on, he is just dealing with the situation in a positive way. Randy knows that he has ten tumors in his stomach and that he only has six months to live; he chooses to spend them with his family rather than worrying about the future. Pausch uses a couple of techniques in his lecture to inspire the audience with his talk. He knows that the audience might get emotional when they learn that he is doing to die soon due to sickness so he creates a sense of humor throughout his lecture as much as possible. For example, he told the audience that even though he is dying soon, I am in much better shape than most of you, and he starts to make push ups to show that them that he is physically strong; the audience respond with laughter and applause. Pausch laughs, smiles and tells a lot of jokes throughout the lecture instead of feeling depressed and sad. Throughout his speech he gives away his stuffed animals, wears an Alice in Wonderland hat, and wears a football jacket because he believes that audience is more likely to have fun and cherish life if they see you doing so in your speeches. Moreover, he could have used a serious tone for this speech. He could have stressed every word as if it were a matter of life or death; however, that would have drawn more attention to his condition instead of his main messag e and the point of the talk was to learn something out of it instead of feeling sorry for him. Due to these reasons, Pausch told the audience at the beginning of the speech that he will not talk about the cancer, wife, or children because the audience is going to get emotional including himself as they are very sensitive topics to discuss. Randy Pausch introduces the main points of the lecture and what he will exactly talk about. Even though Pausch tries to give the impression that the speech is not personal, to some extent it is as the content of the speech are on the personal lessons Randy Pausch has learned through life, and he illuminates these through personal stories. The first topic he addressed is his own childhood dreams and shows the audience pictures of him as a child smiling and looking happy all the time to reveal that he had a great childhood. He also stated that one of the many great things that his parents allowed him to do is paint his own room as he had the chance to express his creativity. As a child he believed that if a man can land on the moon, anything is possible. As a child he always wanted to become an astronaut but he never did; however, NASA created a competition for college students to design a certain project and the winners would go up in to the air in Vomit Comet, (a plane used by astron auts to practice before traveling to the moon) and experience weightlessness as if they are on the moon. Pausch was so excited that his students won until he learns that faculty members are not allowed to join. He makes this point by explaining that this was like a brick wall in his life and Brick walls are there for a reason, they let us prove how badly we want things. Moreover, he didnt give up and he had to fake as a journalist as they were allowed on the plane. Another dream that Pausch shared is the dream of becoming a professional football player and play for the national team which he never did. I got more out of that dream that I didnt accomplish, more than any other dream that I did accomplish. Also, his coach in school would make him do extra push ups, laps, and practice so Randy thought he was making him practice extra just because he didnt think he was good enough until someone told him when you are screwing up and no one is bothering to tell you anything , thats when they give up on you. Moreover, the critiques in our lives are the ones who basically love you and care about you. Also, Randy tells the audience that even though he never got to play as a professional football player, football is still a part of him and while talking, he wears his football jacket and ball and starts playing with it. Another point that Pausch makes that I personally thought it was important is that almost every thing we learn, we learn indirectly. He e xplains that by saying that when we send our children to play football, we dont actually send them to play football but we actually send them to learn skills like teamwork and sportsmanship. Another dream that Pausch shared is the dream of sharing knowledge with other and he did when he was selected to write an article in Wikipedia. Pausch believes that one of the most significant things in life is to share knowledge and pass it on to others. He expresses his humor by saying that being selected to be an author of Wikipedia, now I know that it is a reliable source that you can use. The next dream he introduced is Being like/ meeting captain Kirk which he intended to write it that way to amuse the audience and make them laugh. It was his childhood dream to be like Captain Kirk because it was a show that taught leadership skills. Even though he wanted to be like Captain Kirk he got to meet the actor. Another dream that Randy talked about is being an imagineer at Disney Land. The first time he went to Disney Land as a kid, instead of saying I want to experience this he said, I want to make stuff like that. One thing Randy learned during his experience that I thought was important is When you are pissed off at somebody, you just have to give them time and they will impress you. I believe that he is right because there is no real reason to be upset at anyone as we are all human beings who make mistakes. Also, life is too short to be upset with loved ones and you never know when your life will end. Moreover, Pausch became one of the imagineers who designed the game of Aladdin and Alice in Wonderland. This experience forever changed him as he learned that artists and engineers can invent great things together. Another important thing that he learned which I also thought was important was that all good things come to an end and you should try to enjoy it as much as you can. Later on, Dr. Pausch taught a course at Carnie Mellon University for ten years about building virtual worlds. When Pausch stopped teaching the course he gave handed it someone better to run this course. When you have something so precious, you should hand it to someone better than you. There are many lessons with certain techniques that he used to persuade the audiences with, which were about life that I thought, are important to mention. Its important to have parents and mentors in your life. In this part of the speech, Pausch showed pictures of his parents on rollercoaster to once more create a sense of humor. Also, he said that it is very important to give up the time to help others as we are blessed to have what weve got and others need our help. Moreover, dont complain, just work harder. He gave an example of a baseball player Jackie Robinson who swore he would not complain if people spat on him. I think he gave this example to imply that people complain too much; he is dying and he chooses not to complain. Also, when he was in school and complaining to his mother, she said I know how you feel, remember when your father was your age he was fighting the Germans. Once again she uses this example to create a sense of positive energy in the atmosphere. Another imp ortant message is Have fun I am dying and I choose to have fun. He believes that he cannot tell other how to have fun; it is like telling a fish how to swim in the sea. Finally, apologize when you screw up. I am sorry, I am wrong, and what can I do to make things better. Pausch believes that many people apologize but they are too egocentric to ask What can I do to make things better? In my opinion one of the most memorable moments in the lecture is when Pausch said focus on others, not you and as an example, he got out a huge birthday cake as its his wifes birthday and the audience started to sing Happy Birthday to his wife. In this moment, Randy reveals his emotional side when he hugged his wife. It is very emotional because although throughout the talk he tried to be as enthusiastic and energetic as possible, when it came to his wife he couldnt resist but give a sad face. Also, showing emotions is one of the best ways for a speaker to connect with an audience. Moreover, throughout the lecture he reveals the dreams that he had as a child and how he fulfilled each dream; but in my opinion, I think he the most important dream of all that he wants to fulfill but cannot is the dream of: to live longer and see his children grow up; unfortunately, he cannot fulfill that dream. Dr. Randy Pausch concluded his lecture in a very strong way by summarizing his key points to get his audience to think about what he said. In addition, he reaches back to one of the concepts introduced earlier which was the head fake and reveals that his entire speech has been a pair of head fakes; which makes the audience rethink the whole speech in their heads. Finally, at the very end he reveals that the whole speech was not for the audience but for his wife and children. As a viewer, I realized that at the end of the lecture that Pausch was seizing every opportunity to make speeches and write a book for his children as they are too young to have memories of their father. Moreover, all the childhood dreams and life lessons he has taught throughout the lecture were talks that he wants his children to one day know about them and follow those life lessons he has talked about. In my opinion, even though Dr. Randy Pausch tried to hide his emotional side throughout the lecture, the lecture was to some extent touching to the audience. The fact that hes dying in a couple of months ,yet giving a lecture on how to achieve your dreams and live your life is somewhat emotional to the audience. In addition, his situation makes the audience feel sorry for him even though if its not his intention to this speech. I believe that the speech wouldnt have been that successful if another person who was not ill would have given the same speech. Besides the skillful techniques Pausch used, the audience wouldnt have been as persuaded as they were by a different person preaching the exact same words because they psychologically feel like the need to listen to him because he is dying and in a way they feel sorry for him. Moreover, I believe this reason is one of the several motives to why Dr. Randy Pausch was listed as one of the hundred most influential people in the world.
Wednesday, September 4, 2019
Comparison of Techniques for Diagnosis of Multiple Sclerosis
Comparison of Techniques for Diagnosis of Multiple Sclerosis Background: There is increased need to develop specific biomarkers for multiple sclerosis (MS) to aid in the diagnosis, improve the management of patients and the monitoring of the effectiveness of treatment. Oligoadenylate synthetase 1 (OAS1) is up regulated by type 1 interferon. A single nucleotide polymorphism (SNP) in exon 7 of OAS1 results in differential enzyme activity. Objective: To correlate different OAS1 genotypes, in patients with relapsing remitting multiple scleroses (RRMS) under interferon-beta (IFN à ²) therapy, with disease activity. Subjects and Methods: OAS1 genotype was assessed in 20 patients with RRMS and 20 age and gender matched healthy controls. All patients were medicated with IFN à ². The patients were subdivided in terms of disease activity assessed by Expanded Disability Status Scale (EDSS), in two groups; group I with minimal disease activity and group II with severely active disease. All patients were followed up every 6 months for a period of 2 years . Results: Genotyping analysis of the OAS1 gene revealed a significant difference between RRMS patients and control group, with lower frequency of GG in patients (25%) compared to controls (65 %) (p = 0.0001). Furthermore, AA genotype was detected 35% of patients compared to 0% in controls (p = 0.01). Regarding disease activity, AA genotype had a significantly higher frequency (71.4%) in patients with severely active disease compared to 15.4% in patients with minimally active disease (p=0.0001). Conclusions: The A-allele is considered risky and the G is protective, so those with the AA genotype in particular should be carefully monitored for evidence of disease activity. Conversely, GG genotype may protect against increased disease activity. Introduction Multiple sclerosis (MS) is an inflammatory demyelinating disease of the central nervous system, the etiology and pathogenesis of which remain largely elusive. The most common form of MS is the relapsingââ¬âremitting form (RRMS), in which episodes of acute worsening of neurological function (relapses) are followed by partial or complete recovery periods (remissions) free of disease progression.1,2 Type 1 interferons (IFNs) are innate immune cytokins that activate the JAK/Stat signaling pathway leading to induction of IFN-stimulated genes. The 2,5-OAS family is central to the IFN antiviral pathway for viruses whose replication includes production of double-stranded RNA. One member of this family of proteins, OAS1, induces RNAseL, resulting in degradation of viral RNA, inhibition of virus replication, and promotion of cellular apoptosis.1 Several OAS1 polymorphisms have been reported; one located at the exon 7 splice-acceptor site results in alternative splicing of the OAS1 mRNA. Although clinical trials have proven the efficacy of interferon-beta (IFN à ²) in the treatment of RRMS2-4, over one-third of patients have continuing significant disease activity.5 On purely clinical grounds, patients have variously been considered to have responded poorly, based on relapse occurrence6-9 or on disability progression while receiving IFN à ² therapy.10 Therefore, cohorts of patients receiving IFN à ² can be informative for evaluating general determinants of disease activity. Aim of work: to examine the relationship between OAS1 genotype and indices of disease activity in RRMS under IFN à ² therapy. Subjects and Methods Twenty patients with RRMS according to revised McDonald criteria11 were enrolled from an outpatient and inpatient population attending Neurology Department, Tanta University Hospital. Twenty unrelated age- and gender-matched volunteers, with no history of MS or other neurologic disease, were recruited as a control group. All patients received IFNà ² therapy and followed up every 6 months over a period of 2 years from January 2010 to January 2012. The Ethics Committee of Hospital approved the study, and a written informed consent was obtained from each participant. For all patients, baseline data collected included disease duration, age at onset, relapse history prior to therapy, and clinical disability measured using the Expanded Disability Status Scale (EDSS).12 Relapses were defined as an episode of neurologic disturbance lasting for at least 24 hours and not caused by a change in core body temperature or infection.13 Disability progression was defined as an increase in EDSS score by 1 point from baseline confirmed at 6 months.5 Genomic DNA was isolated from peripheral blood samples. Primers were designed to specifically amplify a 347-bp product surrounding the rs10774671 SNP. A total of 5 grams of genomic DNA was amplified by PCR. Primer sequences used were; rs 10774671 ââ¬â forward, TCCAGATGGCATGTCACAGT and reverse, AGAAGGCCAGGAGTCAGGA. Amplification conditions included initial denaturation at 94 centigrade for 2 minutes, followed by 28 cycles at 94 centigrade for 20 seconds, 62 centigrade for 40 seconds 72 centigrade for 30 seconds, with a final extension for 7 minutes at 72 centigrade. The PCR products were digested with the ALU1 restriction enzyme. Digested products were analyzed by agrose gel electrophoresis and genotypes were assigned, the A-allele coding for a truncated form with low activity and the G conferring high enzymatic activity. Patients were assigned to 1 of 2 groups. Group I included minimal disease activity; patients who experienced a maximum of 1 relapse after 24 months of IFNà ² therapy and had no sustained disability progression. Group II included a severely active disease; patients who had 2 or more relapses on IFNà ² therapy over 24 months with or without sustained disability progression.14 Statistical Analysis SPSS 10 was used for data analysis.15 P value
Possibility of a Future Avian Flu Pandemic Essay -- Bird Flu Influenza
Possibility of a Future Avian Flu Pandemic Influenza is a dangerous virus and highly contagious that has potential to devastate populations should an outbreak occur. A common influenza virus that humans are familiar with is the human influenza. Researchers and scientists are concerned about an especially threatening strain of influenza virus called H5N1, commonly known as the avian flu. Although this flu is mainly susceptible to wild birds, there have been outbreaks that show that humans also become infected. Predictions that the H5N1 strain may lead to a global pandemic are fueling further research of the virus. Studies show that although this virus is currently under control, it is possible that it could mutate and become a worldwide catastrophe. Influenza is a virus that attacks the upper respiratory tract. Influenza, known most, as the Flu is usually painful and can perpetuate symptoms for up to 2 weeks. If everyone had the Flu all of mankind will vanish. Because influenza is a virus there are not any antibiotics that will cure an infection. The human body is designed to fight viral infections through the immune response. Although rarely fatal, the virus usually kills people with weak immune systems, which are often elderly people and young children. About 35,000 people die each year. (Paul Tambyah-pg 6) More public education is needed so that the general population can identify symptoms and seek timely treatment. Getting the flu shot can really save the hassle of being infected. If someone has come down with this virus, stressing out about everyday things can irritate the immune system. Influenza, which belong to a family of viruses called Orthomyxoviruses was first discovered in 1918 and was thought of as a fragile vir... ... ? If handling an infected patient be sure to sterilize all instruments used. The world can never be too cautious for certain illnesses such as this one. There are many strains of the influenza virus. These two viruses are similar and different in a way. Universally scientists and researchers are trying to keep this issue from becoming the worlds next pandemic. Although the virus mutates and changes each year we should not worry, but we should be concerned and follow safe steps as shown above. Keeping the world safe is what we all want and need which will be beneficial for the generations that are soon to come. Bibliography 1. Nemours Foundation- http://kidshealth.org/teen/infections/bacterial_viral/flu.html -Title: Flu facts 2. Bird Flu by Paul Tambyah 3. World health organization- http://www.who.int/csr/disease/avian_influenza/en/ -Title: avian influenza
Tuesday, September 3, 2019
Dictating Lies and Deception Essay -- Terrorism, Bush
September 11, 2001 marked a tragic day in the history of the United States; a terrorist attack had left the country shaken. It did not take long to determine those who were behind the attack and a call for retribution swept through the nation. Citizens in a wave of patriotism signed up for military service and the United States found resounding international support for their efforts in the war on terror. Little opposition was raised at the removal of the Taliban regime and there was much support for bringing Osama Bin Laden and the leaders of al-Qaeda to justice. Approval abroad diminished approximately a year and a half later when Afghanistan became a stepping stone to the administrationââ¬â¢s larger ambition, the invasion of Iraq. The administration would invent several stories and in some cases remain silent of the truth where would prove positive for the Iraqi invasion. It seems they were willing to say anything to promote the largely unpopular and unnecessary war they were resolved on engaging in. Bush had been eager to go to war with Iraq from the moment he stepped into office and the administration's focus was chiefly on Iraq even before the war in Afghanistan had begun. In Where Men Win Glory, the text reveals that ââ¬Å"in November 2001, President Bush and Vice President Cheney had instructed Secretary of Defense Donald Rumsfeld to secretly create a detailed plan for the invasion of Iraqâ⬠(Krakauer 192). Though it is almost unthinkable, the United States had been attacked this very month by al-Qaeda. The government should have been duty bound on capturing Osama Bin Laden and disbanding the terrorist group al-Qaeda. Instead, they were fashioning Iraqi invasion plans. Krakauer establishes additional proof of this stating, ââ¬Å"th... ...n Iraq to be over. Yet, the war was far from over and Iraqis were still fighting against what they perceived as an occupation of their country by the United States. As poignantly realized five years later when over 10,000 Iraqis assembled at the very location of the statues toppling for a truly historic event. The New York Times describes that ââ¬Å"[the Iraqis] gathered in Baghdadââ¬â¢s Firdos Square â⬠¦ to protest the security agreement with the United States that is scheduled for a voteâ⬠and ââ¬Å"demonstrators hanged a black-hooded effigy of President Bush from a column with powerful symbolism: it supported the statue of Saddam Hussein that was toppled by American troops in April 2003â⬠(Farrell et al.). In May of the following year the Bush Administration would revisit its previous devices to conceal the truth of the circumstances surrounding the death of Patrick Tillman.
Monday, September 2, 2019
Assessing the Goal of Sports Products, Inc Essay
Sports Products Inc. is a large producer of boating equipments and accessories. The two key players within this organization is Loren Segura who works as a Clerical assistant in the accounting department and Dale Johnson who works in the shipping department. Both team members had a concern about the company profits and was equally concerned about the stocks declining in value therefore, Loren and Dale try to strategize what is important to management and how the current options affect their pay directly. (Gitman,2009) Solution a. What should the management of Sports Products, Inc. pursue as its overriding goal? Why? Sports Products Inc. will definitely want to maximize their shareholders wealth, which should be the most important goal of an organization although; profit is required to increase the dividends of the company. The managers in Sports Products Inc. must focus on how the organization will continue to profit however; shareholders wealth will increase or maximize while they focus on maintaining their status of providing excellent boating equipment and accessories to their clientele. The firm will also need to come up with a way to incorporate pollution control for the existing problems and a way to pay the additional cost it will incur. The study indicates that the firm has never paid any cash dividends in their twenty-year history and this is how stockholders receive their profit from the organizations earnings. Shareholders fall secondary when it comes to receiving cash dividends or profit because, a shareholder only profits after everyone else in line has received their payments such as the organizations creditors, or suppliers which explains why Sports Products Inc. is being sued by various officials for dumping waste in adjacent streams. The company has chosen not invest in paying for pollution control as this will increase cost to the company and lower the company profit margin. By the shareholders, owning the firm places them at a greater risk and by them owing other companies for risking pollution no one will want to invest in the company although, the profits are rising there is no increase in the firmââ¬â¢s stock price. b. Does the firm appear to have an agency problem? Explain. There does appear to be an agency problem because, regardless of Dales and Loren efforts to manage their jobs by trying not to waste packaging material and performing their job as cost-effective as possible the stock price is still declining $2 per share over a 9 month period which is a large decline under a year time-frame. The company also, does not seem to be concerned about incorporating a pollution control program because; the company is concerned over the cost to themselves and their company profit margin. c. Evaluate the firmââ¬â¢s approach to pollution control. Does it seem to be ethical? Why might incurring the expense to control pollution be in the best interests of the firmââ¬â¢s owners despite its negative effect on profits? To be honest, I am unsure why this would happen ethically. Sports Products Inc. will eventually have to take responsibility on a higher level if these other companies go through with the lawsuits. Therefore, the organization will be forced into either incorporating a pollution control plan or paying fines, which will reduce shareholders wealth even more because, at this point the shareholders cannot receive anything until their creditors are paid in full. d. Does the firm appear to have an effective corporate governance structure? Explain any shortcomings. The structure of Sports Products Inc. appears poorly structured. The management teams are not focused on the shareholders wealth at all. The management structure wants to maintain company profit to break even however, they are not concerned about dumping waste into streams or, creating a pollution control plan. The company is not assuring their stockholders wealth is maximized and if they have not paid cash dividends in 20 years they are just trying to stay in business however, they are not taking care of their employees who work from them everyday nor, does the company have the shareholders best interest at heart. e. On the basis of the information provided, what specific recommendations would You offer the firm? Based on the case study I would recommend Sports Products Inc. forming a better plan that will not just break even however, strategize how to incorporate a pollution control program that will be cost-effective and not affect profits if possible. I would recommend that they incorporate better ethical values that will show integrity to their constituents and internal employees. The organization will need to continue to profit but they also, need to ensure that the shareholders get a piece of the pie in addition, to changing the standards that have been in place for 20 years.
Sunday, September 1, 2019
Crime and Legal System Essay
In the wide field of condemnable justness. one peculiar issue critically relevant in the concern of offense bar and societal control is juvenile delinquency due chiefly to the fact that its mark population are the bush leagues in the society. The construct of juvenile delinquency by and large encompassed legion concerns viz. the offenses affecting minor wrongdoers. the tribunal system to turn to these instances. the penalty attack for the immature person. and others relevant in accomplishing an effectual attack for accomplishing the ideal justness for these immature wrongdoers. In this chase. integrating sociological constructs can so advance development in the effectivity of the condemnable justness system for instances of juvenile delinquency. In analysing the condemnable justness system for minor wrongdoers. it is critically of import to see several factors straight related to the effectual accomplishment of its map. Among these factors are the consequence of the penalty to the minor wrongdoer. good options for the condemnable penalty. motivational schemes of behavioural development. influence of personality background. and others. Integrating the sociological position in this concern. the said field explains that the household construction. environment. and civilization are influential factors to the individualââ¬â¢s personality and behavioural development as such. should be considered in finding the appropriate action for instances of juvenile delinquency. Indeed. integrating this attack will uncover a more appropriate. efficaciously quarreling. and motivational action towards turn toing the personal jobs of the immature wrongdoers ensuing to their juvenile delinquency. Indeed. sociological. the young person period in the timeline of each person is a critical status wherein the individual encounter personality confusion and individuality battle. During this period. the fickle behavioural alterations in the individual can ensue to aggressive actions and determinations and if influenced by negative factors can ensue to juvenile delinquency. As such. nearing the position through a sociological position. it is more advantageous to undertake the job by assisting the wrongdoer header up with his or her personal alterations and battle and steer the individual to the proper manner. Indeed. developing the penalty system in this attack can ensue to an effectual juvenile justness system that promote healthy development through steering the misdemeanour of the minor wrongdoers towards fruitful growing and development for their benefit. In this attack. the issue of juvenile delinquency will be addressed by minimising the job and taking this attack as a mean of assisting the young person through the growing.
Subscribe to:
Posts (Atom)